Uptake of fatty acids by Mycoplasma capricolum.
نویسنده
چکیده
The energy requirements for fatty acid uptake by Mycoplasma capricolum were studied. Fatty acid transport and esterification to phospholipid appeared to be tightly coupled, since there was little intracellular accumulation of free fatty acid. Uptake was blocked by iodoacetate, n-ethylmaleimide, and p-chloromercuribenzoate. Glucose, glycerol, and potassium ions were necessary for fatty acid uptake by whole cells. A reduction in uptake was observed in cells treated with valinomycin or dicyclohexylcarbodiimide. The effect of temperature on the rate of oleate uptake showed a discontinuity at 24 degrees C. Above 24 degrees C an energy of activation of 4.6 kcal (ca. 19.2 kJ)/mol was obtained. The data suggest that uptake of fatty acid by M. capricolum is an energy-linked, protein-mediated process. A membrane-bound enzyme activity that catalyzed the synthesis of fatty acyl-hydroxamate was demonstrated. This activity was virtually independent or only marginally dependent on coenzyme A, depending on the assay system, but was stimulated approximately twofold by ATP.
منابع مشابه
Effect of cholesterol on macromolecular synthesis and fatty acid uptake by Mycoplasma capricolum.
The rates of protein and lipid synthesis of Mycoplasma capricolum were essentially synchronous during growth and depended on the sterol supplement in the media increasing in the order cholesterol (0.5 microgram/ml) < lanosterol (10 microgram/ml) < lanosterol (10 microgram/ml) + cholesterol (0.5 microgram/ml) < cholesterol (10 microgram/ml). The effect of lanosterol plus low cholesterol on macro...
متن کاملDetection of Mycoplasma capricolum capricolum from goats of Qom province, Iran
Mycoplasma capricolum subsp capricolum (Mcc) is one of the etiological agents of contagious agalactia(C.A) in goats which can cause significant economic losses. The aim of this study was to detect Mcc from goats of Qom province in Iran. A total of 111 samples were collected from suspected goats to C.A and cultured in PPLO broth supplemented for Mcc isolation. The bacteria DNAs were extracted ...
متن کاملThe nucleotide sequence of 5S rRNA from Mycoplasma capricolum.
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.
متن کاملStable RNA synthesis and its control in Mycoplasma capricolum.
The synthesis of stable RNA in Mycoplasma capricolum was studied by [32P] labeling of cellular RNA of cells grown in a partially-defined medium in the presence or absence of an amino acid mixture supplement. The results indicate that M. capricolum employs the same stringent control mechanism used by E. coli cells, as judged by a decreased synthesis of stable RNA and accumulation of 5'-triphosph...
متن کاملPhospholipids as acyl donors to membrane proteins of Mycoplasma capricolum.
Mycoplasma capricolum, a procaryotic sterol and fatty acid auxotroph, contains a large number of membrane proteins covalently modified by both saturated and unsaturated fatty acids (Dahl, C.E., Dahl, J.S., and Bloch, K. (1983) J. Biol. Chem. 258, 11814-11818). Pulse-chase experiments show that the radioactivity in the fatty acid moieties of the acyl proteins increases rather than decreases duri...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Journal of bacteriology
دوره 170 5 شماره
صفحات -
تاریخ انتشار 1988